From 11:00 pm to 12:00 pm EST ( 8:00 pm to 9:00 pm PST ) on January 6th, the website will be under maintenance. We are sorry for the inconvenience. Please arrange your schedule properly.
Hydroxystilbamidine bis(methanesulfonate), a dye capable of binding to both DNA and RNA, has been found to be a powerful inhibitor of cellular ribonucleases.
Phenosafranine is a phenazine dye. Phenosafranine has high binding affinity to triplex RNA compared to the parent duplex form, binds through intercalation to both forms of RNA. Phenosafranine can be used for staining plant cells, determination of hemoglobin, dopamine, serotonin and so on .
TAT-CIRP is a a small peptide, refers to Trans-trans-activating (Tat)-cold-inducible RNAbinding protein. TAT-CIRP is an inhibitor of myeloid differentiation protein 2 (MD2). TAT-CIRP exhibits robust neuroprotection against ischemic and hemorrhagic stroke in mice .
Azaphilone-9 (AZA-9) is an inhibitor of HuR-ARERNA interaction (IC50=1.2 μM) by bindingRNA-binding protein Hu antigen R (HuR). The HuR-RNA interactions stabilize many oncogenic mRNAs in tumors. Thus Azaphilone-9 potentially inhibit cancer cell growth and progression .
Gossypolone is an RNA-binding protein Musashi-1 inhibitor with a Ki of 12 nM. Gossypolone disrupts the Musashi-numb RNA interaction and directly binds to the RBD1 of MSI1 protein. Gossypolone can be used for the research of cancer .
Ulefnersen is a RNA-binding protein fused-in sarcoma (FUS) synthesis reducer . Ulefnersen can be used in Amyotrophic Lateral Sclerosis (ALS) research .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Hydroxystilbamidine, a dye capable of binding to both DNA and RNA, is a powerful inhibitor of cellular ribonucleases. Hydroxystilbamidine is a retrograde fluorescent tracer and a histochemical stain [1]
RNA Aptamer Mango Ⅱ (sodium) has an exceptionally high affinity to TO1-biotin (a thiazole orange derivative fluorophore), and can be used to visualize RNA expression or localization in live cells. Compared to the original Mango I aptamer, RNA Aptamer Mango Ⅱ (sodium) has markedly improved fluorescent properties, binding affinities, and salt dependencies.
RNA Aptamer Mango Ⅳ (sodium) has an exceptionally high affinity to TO1-biotin (a thiazole orange derivative fluorophore), and can be used to visualize RNA expression or localization in live cells. Compared to the original Mango I aptamer, RNA Aptamer Mango Ⅳ has markedly improved fluorescent properties, binding affinities, and salt dependencies.
RNA Aptamer Mango Ⅲ (sodium) has an exceptionally high affinity to TO1-biotin (a thiazole orange derivative fluorophore), and can be used to visualize RNA expression or localization in live cells. Compared to the original Mango I aptamer, RNA Aptamer Mango Ⅲ has markedly improved fluorescent properties, binding affinities, and salt dependencies.
Okicenone is a Hu protein R (HuR) inhibitor. Okicenone inhibits HuR oligomerization, interferes with HuR RNAbinding, HuR trafficking, cytokine expression and T-cell activation .
UNC4976 is a positive allosteric modulator (PAM) peptidomimetic of CBX7 chromodomain binding to nucleic acids. UNC4976 simultaneously antagonizes H3K27me3-specific recruitment of CBX7 to target genes while increasing non-specific binding to DNA and RNA .
NSC 194308, a U2AF2-RNA complexes enhancer, increases association of the U2AF1-U2AF2-SF1-splice site RNA complex by binding a site between the U2AF2 RNA recognition motifs (RRM1 and RRM2). NSC 194308 inhibits pre-mRNA splicing by stalling spliceosome assembly at the point where U2AF helps recruit U2 snRNP to the branchpoint. NSC 194308 enhances the binding of pre-mRNA to U2AF2, selectively triggering cell death in leukemia cell lines containing spliceosome mutations .
SMN-C2, an analog of RG-7916, is a selective modulator of SMN2 gene splicing that acts by binding SMN2 pre-mRNA, thereby increasing far upstream element binding protein 1 (FUBP1) and KH-spliced RNAbinding Protein affinity regulator protein (KHSRP) to the SMN2 pre-mRNA complex. SMN-C2 can be used in spinal muscular atrophy (SMA) research .
Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.
ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNAbinding region of VP40 .
Ro 08-2750 is a non-peptide and reversible nerve growth factor (NGF) inhibitor which binds to NGF, and with an IC50 of ~ 1 µM. Ro 08-2750 inhibits NGF binding to p75 NTR selectively over TRKA . Ro 08-2750 is a selective MSI RNA-binding activity inhibitor, with an IC50 of 2.7 μM .
UNC4976 TFA is a positive allosteric modulator (PAM) peptidomimetic of CBX7 chromodomain binding to nucleic acids. UNC4976 TFA simultaneously antagonizes H3K27me3-specific recruitment of CBX7 to target genes while increasing non-specific binding to DNA and RNA .
TMV-IN-6 (Compound 4g) is a novel antiviral and fungicidal agent. TMV-IN-6 inhibits virus assembly by bindingtotobacco mosaic virus (TMV) CP and interfere with the assembly process of TMV CP and RNA .
Clemizole hydrochloride is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole hydrochloride is an inhibitor of TRPC5 channel. The IC50 of Clemizole hydrochloride for RNAbinding by NS4B is 24 nM, whereas its EC50 for viral replication is 8 µM.
8-Azanebularine, a compound with hydrogen in place of the C6 amino group, inhibits the ADAR2 reaction at high concentrations (IC50=15 mM). 8-Azanebularine is incorporated into an RNA structure recognized by human ADAR2 results in high-affinity binding (KD=2 nM). 8-Azanebularine can be used for the research of ADAR-catalyzed RNA-editing reaction .
Clemizole is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole is an inhibitor of TRPC5 channel. The IC50 of Clemizole for RNAbinding by NS4B is 24±1 nM, whereas its EC50 for viral replication is 8 µM.
3-Deaza-2 '-deoxyadenosine is a nucleoside analog synthesized from 2' -deoxyadenosine. 3-Deaza-2 '-deoxyadenosine inhibits RNA synthesis by binding to ribose fragments of ribonucleotides, thereby preventing the formation of enzyme-substrate complexes, thereby preventing chain elongation, It can also inhibit DNA synthesis by binding deoxyribose fragments of DNA and preventing DNA polymerase from adding nucleotides to the growth chain. 3-Deaza-2 '-deoxyadenosine has antiviral activity .
Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .
Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .
Tedizolid- 13C,d3 is the 13C- and deuterium labeled Tedizolid. Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.
(R)-SKBG-1 is an RNA-binding protein NONO inhibitor. (R)-SKBG-1 suppresses androgen receptor expression with IC50s of 3.1 μM and 5.5 μM against AR-FL mRNA and AR-V7 mRNA, respectively .
RNA Aptamer Broccoli (sodium) is a 49-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright green fluorescence upon binding DFHBI or DFHBI-1T (soluble analogs of the fluorophore of green fluorescent protein). RNA Aptamer Broccoli (sodium) can be used to visualize RNA expression or localization in live cells. In vitro Broccoli exhibits a similar high folding efficiency as Spinach2, but exhibits markedly lower dependence on magnesium for folding and increased thermostability. Additionally, unlike Spinach2, Broccoli does not require the use of a tRNA scaffold to promote its folding in vivo.
Nogalamycin is an anthracyclinone antibiotic. Nogalamycin is a potent antibiotic against Gram-positive bacteria, also has cytotoxicity against certain tumor cells. Nogalamycin is produced by Streptomyces nogalater var. Nogalater. Nogalamycin selectively inhibits RNA synthesis after binding to DNA template. Nogalamycin can be used for researching anticancer .
Hycanthone is a thioxanthenone DNA intercalator and inhibits RNA synthesis as well as the DNA topoisomerases I and II. Hycanthone inhibits nucleic acid biosynthesis and inhibits apurinic endonuclease-1 (APE1) by direct protein binding with a KD of 10 nM. Hycanthone is a bioactive metabolite of Lucanthone (HY-B2098) and has anti-schistosomal agent .
Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .
Oxytetracycline calcium is an antibiotic belonging to the tetracycline class. Oxytetracycline calcium potently inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline calcium is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline calcium also possesses anti-HSV-1 activity .
RNA Aptamer Corn (sodium) is a 28-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright red fluorescence upon binding DFHO (a soluble analog of the intrinsic fluorophore of red fluorescent protein), RNA Aptamer Corn (sodium) can be used to visualize RNA expression or localization in live cells which have been soaked with chromophores. The Corn-DFHO does not become appreciably cytotoxic when illuminated. And most importantly, Corn-DFHO exhibits markedly increased photostability compared to other aptamer-chromophore complexes both in vitro and in vivo. (36 nt Corn construct: 5'-GGCGCGAGGAAGGAGGUCUGAGGAGGUCACUGCGCC-3'; A 36-nt RNA construct, comprised of the 28-nt minimal Corn sequence extended proximally with a 4 base-pair stem.)
Erythromycin-d6 is the deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1].
TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC50=1.2 μM) and poliovirus by interfering with the synthesis of viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP) .
AVG-233 is a potent, orally active RNA dependent RNA polymerase (RdRp) inhibitor. AVG-233 prevents initiation of the viral polymerase complex at the promoter. AVG-233 binding site is present in the L1-1749 fragment. AVG-233 has nanomolar activity against both RSV strains and clinical RSV isolates (EC50=0.14-0.31 μM). AVG-233 can be used for research of respiratory syncytial virus (RSV) .
TK216 is an orally active and potent E26 transformation specific (ETS) inhibitor . TK216 directly binds EWS-FLI1 and inhibits EWS-FLI1 protein interactions. TK216 blocks the binding between EWS-FLI1 and RNA helicase A. TK216 has anticancer activity .
Anticancer agent 73 (compound CIB-3b) is a anticancer agent, potently targeting TAR RNA-binding protein 2 (TRBP) and disrupts its interaction with Dicer. Anticancer agent 73 can rebalance the expression profile of oncogenic or tumor-suppressive miRNAs. Anticancer agent 73 suppresses the proliferation and metastasis of HCC in vitro and in vivo .
KH-3 is a potent RNA-binding protein Hu antigen R (HuR) inhibitor with an IC50 value of 0.35 μM. KH-3 has anti-proliferative activity. KH-3 suppresses breast cancer cell invasion as well as delays the initiation of lung colonies by disrupting HuR-FOXQ1 mRNA interaction .
Setrobuvir (ANA598) is an orally active non-nucleosidic HCV NS5B polymerase inhibitor. ANA-598 inhibits both de novo RNA synthesis and primer extension, with IC50s between 4 and 5 nM. Setrobuvir also shows excellent binding affinity to SARS-CoV-2 RdRp and induces RdRp inhibition .
Erythromycin- 13C,d3 is the 13C- and deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1].
YK-4-279 blocks RNA Helicase A (RHA) binding with EWS-FLI1 (oncogenic protein). YK-4-279 induces apoptosis and shows anti-proliferation activities towards various cancer cells. YK-4-279 has a chiral center and it can be separated into two enantiomers. YK-4-279 can be used for the research of cancer .
Thailanstatin A is an ultra-potent inhibitor of eukaryotic RNA splicing (IC50=650 nM). Thailanstatin A exerts effects via non-covalent binding to the SF3b subunit of the U2 snRNA subcomplex of the spliceosome and shows low-nM to sub-nM IC50s against multiple cancer cell lines. Thailanstatin A, a payload for ADCs, is conjugated to the lysines on trastuzumab yielding “linker-less” ADC .
Framycetin (Neomycin B), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections .
IMT1 is a first-in-class specific and noncompetitive human mitochondrial RNA polymerase (POLRMT) inhibitor. IMT1 causes a conformational change of POLRMT, which blocks substrate binding and transcription in a dose-dependent way in vitro. IMT1 reduces deoxynucleoside triphosphate levels and citric acid cycle intermediates, resulting in a marked depletion of cellular amino acid levels. IMT1 has the potential for mitochondrial transcription disorders related diseases .
Framycetin sulfate (Neomycin B sulfate), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin sulfate competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin sulfate inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin sulfate, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections .
CMLD-2, an inhibitor of HuR-ARE interaction, competitively binds HuR protein disrupting its interaction with adenine-uridine rich elements (ARE)-containing mRNAs (Ki=350 nM). CMLD-2 induces apoptosis exhibits antitumor activity in different cancer cells as colon, pancreatic, thyroid and lung cancer cell lines. Hu antigen R (HuR) is an RNAbinding protein, can regulate target mRNAs stability and translation .
FAZ-3532 (compound G3Ia) is an inhibitor of binding to the NTF2L domain of G3BP1/2 that binds to G3BP1 with a Kd of 0.54 μM. FAZ-3532 targets the protein-protein interaction domain of G3BP1/2 and specifically inhibits co-condensation of G3BP1, caprin 1, and RNA in vitro .
FAZ-3780 (compound G3Ib) is an inhibitor of binding to the NTF2L domain of G3BP1/2 that binds to G3BP1 with a Kd of 0.15 μM. FAZ-3780 targets the protein-protein interaction domain of G3BP1/2 and specifically inhibits co-condensation of G3BP1, caprin 1, and RNA in vitro .
Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .
Enoxacin hydrate (Enoxacin sesquihydrate), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin hydrate is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin hydrate has potent activities against gram-positive and -negative bacteria. Enoxacin hydrate is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .
eIF4A3-IN-1 (compound 53a) is a selective eukaryotic initiation factor 4A3 (eIF4A3) inhibitor (IC50=0.26 μM; Kd=0.043 μM), which binds to a non-ATP binding site of eIF4A3 and shows significant cellular nonsense-mediated RNA decay (NMD) inhibition at 10 and 3 μM and can be as a probe for further study of eIF4A3, the exon junction complex (EJC), and NMD .
LIN28-IN-1 (compound 5) is an inhibitor of the RNA-binding and regulatory protein LIN28 and binds to the LIN28 cold shock domain (CSD). LIN28-IN-1 effectively inhibits the interaction between LIN28 and let-7 miRNA (IC50: 5.4 μM), blocking the negative impact of LIN28 on epigenetic gene regulation. LIN28-IN-1 significantly inhibits the proliferation of JAR cancer cells expressing LIN28 (IC50: 6.4 μM) .
NSC260594 induces Apoptosis. NSC260594 binds the shallow groove of the Mcl-1 protein, and inhibits Mcl-1 expression through down-regulation of Wnt signaling proteins. NSC260594 can also recognize G9-G10-A11-G12 RNA tetraloop of HIV and prevent the binding of the Gag protein within the 5’-UTR. NSC260594 inhibits tumor growth, and can be used for research of Triple-negative breast cancers (TNBCs) .
Enoxacin-d8 (hydrochloride) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing[1][2][3][4].
COVID-19 Spike Protein mRNA will express COVID-19 spike protein, and suitable for detection of RNA delivery, translation efficiency, cell viability, etc. COVID-19 spike protein is the novel coronavirus pneumonia spike protein located on the membrane surface. COVID-19 spike protein undertakes the functions of virus binding to host cell membrane receptors and membrane fusion, thereby mediating the entry of COVID-19 virus into cells. COVID-19 spike protein is an important site of action for host neutralizing antibodies and a key target for vaccine design .
COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing COVID-19 Spike Protein, suitable for detection of RNA delivery, translation efficiency, cell viability, etc. COVID-19 Spike Protein is the novel coronavirus pneumonia spike protein located on the membrane surface. COVID-19 Spike Protein undertakes the functions of virus binding to host cell membrane receptors and membrane fusion, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design .
Poly (I:C):Kanamycin (1:1) sodium is an isometric complex of Poly (I:C) (HY-135748) and Kanamycin (HY-16566). Poly(I:C) sodium, a synthetic analog of double-stranded RNA, is a TLR3 and retinoic acid-inducible gene I receptor (RIG-I and b>MDA5) agonist. Poly(I:C) sodium can be used as a vaccine adjuvant to enhance innate and adaptive immune responses and induce apoptosis in cancer cells . Kanamycin is an orally active antibacterial agent (Gram-negative/positive bacteria) that inhibits translocation and causes miscoding by binding to the 70S ribosomal subunit. Kanamycin shows good inhibitory activity against Mycobacterium tuberculosis (susceptible and drug-resistant) and Klebsiella pneumoniae, and can be used in the research of tuberculosis and pneumonia .
T-2 Toxin (T-2 Mycotoxin) is a toxic trichothecene mycotoxin produced by various Fusarium species in feedstuffs and cereal grains, LD50 values of T-2 Toxin in mice and rats are 5.2 and 1.5 mg/kg BW a,respectively . T-2 Toxin (T-2 Mycotoxin) can be transformed into a variety of metabolite, the typical metabolites of T-2 toxin in animals are HT-2 toxin and T-2-triol, which are hydrolysates . T-2 Toxin (T-2 Mycotoxin) is an inhibitor of protein synthesis resulting from binding peptidyltransferase, which is an integral part of the 60s ribosomal subunit. T-2 Toxin (T-2 Mycotoxin) inhibits the synthesis of DNA and RNA, interferes with the metabolism of membrane phospholipids, and increases the level of liver lipid peroxides . T-2 Toxin (T-2 Mycotoxin) induces apoptosis in the immune system, gastrointestinal tissues, and fetal tissues .
According to reports, most known kinase inhibitors exert their effects through competitive binding in highly conserved ATP pockets. Although genetic techniques such as RNA interference can inactivate specific genes, most kinases are multi domain proteins, each of which has an independent function. Highly selective inhibitors have higher efficiency than non-selective inhibitors, and the selectivity to the target is at least 100 times higher. Therefore, ensuring the validation of targets with the most selective inhibitors is crucial for a more thorough understanding of the pharmacology of the kinase field. The Highly Selective Inhibitors Library contains 4653 compounds, covering multiple targets and subtypes, such as GPCR protein family, Ion channel, multiple kinases, etc. The Highly Selective Inhibitors Library is an effective tool for screening different phenotypes
Hydroxystilbamidine bis(methanesulfonate), a dye capable of binding to both DNA and RNA, has been found to be a powerful inhibitor of cellular ribonucleases.
Phenosafranine is a phenazine dye. Phenosafranine has high binding affinity to triplex RNA compared to the parent duplex form, binds through intercalation to both forms of RNA. Phenosafranine can be used for staining plant cells, determination of hemoglobin, dopamine, serotonin and so on .
COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing COVID-19 Spike Protein, suitable for detection of RNA delivery, translation efficiency, cell viability, etc. COVID-19 Spike Protein is the novel coronavirus pneumonia spike protein located on the membrane surface. COVID-19 Spike Protein undertakes the functions of virus binding to host cell membrane receptors and membrane fusion, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design .
PTBP1-RNA-binding inhibitor P6 (PTBP1 α3-helix derived peptide P6) TFA is a stapled peptide inhibitor of the splicing factor PTBP1, which inhibits alternative splicing events regulated by PTBP1. PTBP1 bindsRNA through its RNA recognition motif .
UNC4976 TFA is a positive allosteric modulator (PAM) peptidomimetic of CBX7 chromodomain binding to nucleic acids. UNC4976 TFA simultaneously antagonizes H3K27me3-specific recruitment of CBX7 to target genes while increasing non-specific binding to DNA and RNA .
TAT-CIRP is a a small peptide, refers to Trans-trans-activating (Tat)-cold-inducible RNAbinding protein. TAT-CIRP is an inhibitor of myeloid differentiation protein 2 (MD2). TAT-CIRP exhibits robust neuroprotection against ischemic and hemorrhagic stroke in mice .
UNC4976 is a positive allosteric modulator (PAM) peptidomimetic of CBX7 chromodomain binding to nucleic acids. UNC4976 simultaneously antagonizes H3K27me3-specific recruitment of CBX7 to target genes while increasing non-specific binding to DNA and RNA .
MCE Viral DNA/RNA Mini Purification Kit allows rapid and efficient purification of viral DNA/RNA based on the selective binding of DNA/RNA to the silica-based membrane. Viral DNA/RNA purified with this kit can be used for PCR, RT-PCR, qPCR, and qRT-PCR.
Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .
T-2 Toxin (T-2 Mycotoxin) is a toxic trichothecene mycotoxin produced by various Fusarium species in feedstuffs and cereal grains, LD50 values of T-2 Toxin in mice and rats are 5.2 and 1.5 mg/kg BW a,respectively . T-2 Toxin (T-2 Mycotoxin) can be transformed into a variety of metabolite, the typical metabolites of T-2 toxin in animals are HT-2 toxin and T-2-triol, which are hydrolysates . T-2 Toxin (T-2 Mycotoxin) is an inhibitor of protein synthesis resulting from binding peptidyltransferase, which is an integral part of the 60s ribosomal subunit. T-2 Toxin (T-2 Mycotoxin) inhibits the synthesis of DNA and RNA, interferes with the metabolism of membrane phospholipids, and increases the level of liver lipid peroxides . T-2 Toxin (T-2 Mycotoxin) induces apoptosis in the immune system, gastrointestinal tissues, and fetal tissues .
Oxytetracycline calcium is an antibiotic belonging to the tetracycline class. Oxytetracycline calcium potently inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline calcium is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline calcium also possesses anti-HSV-1 activity .
RBM14; SIP; RNA-binding protein 14; Paraspeckle protein 2; PSP2; RNA-binding motif protein 14; RRM-containing coactivator activator/modulator; Synaptotagmin-interacting protein; SYT-interacting protein
The RBM14 protein has different isoforms with multiple functions. Isoform 1 enhances transcription as a nuclear receptor coactivator, interacting with NCOA6 and CITED1. RBM14 Protein, Human (His-SUMO) is the recombinant human-derived RBM14 protein, expressed by E. coli , with N-SUMO, N-6*His labeled tag. The total length of RBM14 Protein, Human (His-SUMO) is 669 a.a., with molecular weight of ~85.5 kDa.
The acnB protein coordinates short-chain fatty acid catabolism through the TCA pathway and 2-methylcitric acid cycle I, demonstrating catalytic versatility. It is involved in the reversible isomerization of citric acid to isocitrate and the hydration of 2-methyl-cis-aconitic acid. acnB Protein, E. coli is the recombinant Virus-derived acnB protein, expressed by E. coli , with tag free. The total length of acnB Protein, E. coli is 865 a.a., with molecular weight of ~95 kDa.
The ESRP1/RBM35A protein is an important mRNA splicing factor, particularly affecting epithelial cell-specific isoforms such as FGFR2-IIIb. During epithelial-mesenchymal transition (EMT), its regulatory influence extends to transcripts including CD44, CTNND1, and ENAH. ESRP1/RBM35A Protein, Human (sf9, His) is the recombinant human-derived ESRP1/RBM35A protein, expressed by Sf9 insect cells , with N-His labeled tag. The total length of ESRP1/RBM35A Protein, Human (sf9, His) is 681 a.a., with molecular weight of ~77.9 KDa.
CIRBP protein, a key player in cellular response to genotoxic stress, stabilizes survival-associated transcripts. It aids stress granule assembly, suppresses cell proliferation in the cold, and regulates translation. CIRBP interacts with EIF4G1, associates with ribosomes, and targets the 3'-UTRs of stress-responsive transcripts like RPA2 and TXN. It contributes to intricate molecular regulatory mechanisms. CIRBP Protein, Mouse (His) is the recombinant mouse-derived CIRBP protein, expressed by E. coli , with N-6*His labeled tag. The total length of CIRBP Protein, Mouse (His) is 172 a.a., with molecular weight of ~24 kDa.
CIRBP is a cold-induced mRNA-binding protein that plays a key role in cellular responses to genotoxic stress, exerting a protective effect by stabilizing transcripts of genes critical for cell survival. As a translation activator, CIRBP appears to be critical for cold-induced inhibition of cell proliferation. CIRBP Protein, Human (His) is the recombinant human-derived CIRBP protein, expressed by E. coli , with N-His labeled tag. The total length of CIRBP Protein, Human (His) is 172 a.a., with molecular weight of ~23 KDa.
ELAV like 3; ELAV like 4; ELAV like neuron specific RNAbinding protein 3; ELAV like neuron specific RNAbinding protein 4; ELAV like protein 3; ELAV like protein 4; ELAV-like protein 3; PLE21; PNEM
ELAVL3 protein is an RNA-binding protein that specifically binds to the ARE sequence in target mRNA, including VEGF. It may also interact with polyA tracts through its RRM3. ELAVL3 Protein, Human (P.pastoris, His) is the recombinant human-derived ELAVL3 protein, expressed by P. pastoris , with N-His labeled tag. The total length of ELAVL3 Protein, Human (P.pastoris, His) is 367 a.a., with molecular weight of ~41.5 kDa.
LRRFIP1 is a transcriptional repressor that preferentially binds to GC-rich sequences (5'-AGCCCCCGGCG-3') and may regulate the expression of TNF, EGFR, and PDGFA. It inhibits PDGFA, which controls smooth muscle cell proliferation after arterial injury. LRRFIP1 Protein, Human (FLAG) is the recombinant human-derived LRRFIP1 protein, expressed by E. coli , with C-Flag labeled tag. The total length of LRRFIP1 Protein, Human (FLAG) is 808 a.a., .
LRRFIP1 is a transcriptional repressor that preferentially binds to GC-rich sequences (5'-AGCCCCCGGCG-3') and may regulate the expression of TNF, EGFR, and PDGFA. It inhibits PDGFA, which controls smooth muscle cell proliferation after arterial injury. LRRFIP1 Protein, Human (His, Strep) is the recombinant human-derived LRRFIP1 protein, expressed by E. coli , with N-Strep, N-6*His labeled tag. The total length of LRRFIP1 Protein, Human (His, Strep) is 808 a.a., .
The EIF3G protein is an RNA-binding component of the eIF-3 complex that initiates protein synthesis by promoting the recruitment of factors to form the 43S PIC. EIF3G is critical in both mRNA recruitment and AUG recognition scanning. EIF3G Protein, Human (His-SUMO) is the recombinant human-derived EIF3G protein, expressed by E. coli , with N-SUMO, N-6*His labeled tag. The total length of EIF3G Protein, Human (His-SUMO) is 319 a.a., with molecular weight of 51.5 kDa.
Erythromycin-d6 is the deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1].
Enoxacin-d8 (hydrochloride) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing[1][2][3][4].
Tedizolid- 13C,d3 is the 13C- and deuterium labeled Tedizolid. Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.
Erythromycin- 13C,d3 is the 13C- and deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1].
PIAS1; DDXBP1; E3 SUMO-protein ligase PIAS1; DEAD/H box-binding protein 1; Gu-binding protein; GBP; Protein inhibitor of activated STAT protein 1; RNA helicase II-binding protein
DAZ homolog; DAZ like autosomal; DAZH; DAZL; DAZL1; DAZLA; Deleted in azoospermia like 1; Germline specific RNAbinding protein; SPGY like autosomal; SPGYLA; Tpx2
